KIAA0839

Gene/Protein Characteristic Table for KIAA0839

Order Kazusa clone(s) from :

Product ID	ORK00651
Accession No	AB020646
Description	RAB3 GTPase activating protein subunit 2 (non-catalytic)
Clone name	hk04507s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-775) was subcloned upstream of the cDNA (776-4961). The adjacent sequence to the 5' end of the cDNA is as follows: GGTACCCGCG GGAATTCGAT T-5' end of cDNA.
cDNA sequence	DNA sequence (4961 bp) Predicted protein sequence (1393 aa)
HaloTag ORF Clone	FHC00651
Flexi ORF Clone	FXC00651
Source	Human adult brain
Rouge ID	mKIAA0839 by Kazusa Mouse cDNA Project
Note	We replaced hk04507, former representative clones for KIAA0839 with hk04507s1. (2002/5/10)

Features of the cloned cDNA sequence

Description

Length: 4961 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	779 bp
Genome contig ID	gi89161185r_218290437
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTGTAAAAATGTATTATCTTGTAAAACTTATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGGCAAAGATACTAAAAATTTTAAGTCCGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	218390437	218512302	35	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 1393 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAC35881	99.9	rab3-GAP regula...	Homo sapiens
XP_514211	99.9	rab3 GTPase-act...	Pan troglodytes
XP_001103011	98.9	similar to rab3...	Macaca mulatta
XP_536122	95.3	similar to rab3...	Canis lupus fam...
XP_001488184	94.6	RAB3 GTPase act...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGCGTATAGAACACCCCACTC
Primer_r	TCCTCAAGCACGGTCATCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp