KIAA0847

Product ID	ORK07237
Accession No	AB020654
Description	tau tubulin kinase 2
Clone name	hk05395
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3386 bp) Predicted protein sequence (645 aa)
Source	Human adult brain
Rouge ID	mKIAA0847 by Kazusa Mouse cDNA Project

Length: 3386 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1447 bp
Genome contig ID	gi51511731r_40723838
PolyA signal sequence (AATACA,-21)	+--------+--------+----*----+---- TTGCTGCCAAACCTAATACAGTTGAATTGGGAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAGAAAGGAATACATTTCCTCCCCAAGTGAACATCTTCTAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	40823838	40854826	3	100.0	Perfect prediction

Length: 645 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW92581	6e-200	100.0	tau tubulin kin...	Homo sapiens
Q6IQ55	7.8e-200	100.0	Tau-tubulin kin...	Homo sapiens
AAH71556	7.8e-200	100.0	TTBK2 protein [...	Homo sapiens
AAO14996	9.6e-200	100.0	tau-tubulin kin...	Homo sapiens
XP_001155158	2.1e-199	99.8	tau tubulin kin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TCATCTCTGTTAAGTGTCCTC
Primer_r	TTGTGCTTCCCTCGTATCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 15

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TCATCTCTGTTAAGTGTCCTC
Primer_r	TTGTGCTTCCCTCGTATCATC
PCR product length	133 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles