Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00640 |
---|---|
Accession No | AB018335 |
Description | transmembrane protein 63A |
Clone name | hk05691 |
Vector information | |
cDNA sequence | DNA sequence (4074 bp) Predicted protein sequence (828 aa) |
HaloTag ORF Clone |
FHC00640
|
Flexi ORF Clone | FXC00640 |
Source | Human adult brain |
Rouge ID |
mKIAA0792
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1400 bp |
---|---|
Genome contig ID | gi89161185r_223999863 |
PolyA signal sequence (AGTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 224099863 | 224136671 | 25 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003864 | 356 | 790 | PF02714 | Protein of unknown function DUF221 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 67 | TFGGIPTVLLIDVSCFLFLILVF | 89 | PRIMARY | 23 | 2 | 166 | HIIFLLVVVSFLSLCVILPVNLS | 188 | PRIMARY | 23 | 3 | 212 | DLLWLHTIFAVIYLFFTVGFMRH | 234 | PRIMARY | 23 | 4 | 446 | INFTLFLGLFFLTTPSIILSTMD | 468 | SECONDARY | 23 | 5 | 487 | FFPTLLLWSFSALLPSIVYYSTL | 509 | PRIMARY | 23 | 6 | 528 | YIFLIFMVLILPSLGLTSLDFFF | 550 | PRIMARY | 23 | 7 | 583 | ASAFIGNGMELLRLPGLILYTFR | 605 | SECONDARY | 23 | 8 | 635 | MLCVFTVIVAYSITCPIIAPFGL | 657 | PRIMARY | 23 | 9 | 689 | VNQALAAPILCLFWLYFFSFLRL | 711 | PRIMARY | 23 | 10 | 717 | ATLFTFLVLLLTILVCLAHTCFG | 739 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CAGCCTCTCTCACCTCTTCAG |
---|---|
Primer_r | ATGCTGTCCTTTGGCTCCGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGCCTCTCTCACCTCTTCAG |
Primer_r | ATGCTGTCCTTTGGCTCCGAG |
PCR product length | 144 bp |
PCR conditions | 95 °C15 sec68 °C60 sec30 cycles |