KIAA0854

Product ID	ORK00659
Accession No	AB020661
Description	zinc fingers and homeoboxes 2
Clone name	hk06169
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4089 bp) Predicted protein sequence (868 aa)
HaloTag ORF Clone	FHC00659
Flexi ORF Clone	FXC00659
Source	Human adult brain
Rouge ID	mKIAA0854 by Kazusa Mouse cDNA Project

Length: 4089 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1271 bp
Genome contig ID	gi51511724f_123844895
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TGTAACTCAATAAAGCAAAGACTAAACATTTTTAT
Flanking genome sequence (211036 - 211085)	----+--------+--------+--------+--------+----* AACCTTTTCCTCTACTTCGCCTTCTTTATTGTCGTCTGGCTCCCGAGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	123944888	124055929	3	98.9	Terminal No-hit

Length: 868 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6X8	100.0	Zinc fingers an...	Homo sapiens
XP_519932	99.6	zinc fingers an...	Pan troglodytes
Q5R7F2	98.8	Zinc fingers an...	Pongo abelii
XP_001497493	93.1	similar to Zinc...	Equus caballus
XP_001928810	92.2	similar to Zinc...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007855	3.1e-14	33.4	KIAA0395

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001356	474	527	PF00046	Homeobox
	IPR001356	563	616	PF00046	Homeobox
	IPR001356	660	716	PF00046	Homeobox
HMMSmart	IPR015880	109	132	SM00355	Zinc finger
	IPR015880	141	164	SM00355	Zinc finger
	IPR001356	294	355	SM00389	Homeobox
	IPR001356	470	532	SM00389	Homeobox
	IPR001356	561	622	SM00389	Homeobox
	IPR001356	659	721	SM00389	Homeobox
ProfileScan	IPR007087	141	169	PS50157	Zinc finger
	IPR001356	478	528	PS50071	Homeobox
	IPR001356	568	618	PS50071	Homeobox
	IPR001356	667	717	PS50071	Homeobox

Primer_f	CACCTTTCTAAATACCAGCAG
Primer_r	TACCACACCGAGAAAAGGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-