Gene/Protein Characteristic Table for KIAA0864
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06032
Accession No AB020671
Description myosin phosphatase Rho interacting protein
Clone name hk06577s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4872 bp)
Predicted protein sequence (1402 aa)
Source Human adult brain
Rouge ID mKIAA0864 by Kazusa Mouse cDNA Project
Note We replaced hk06577, former representative clones for KIAA0864 with hk06577s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4872 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1402 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW55722 0 99.9 myosin phosphat...
Homo sapiens
XP_001160711 0 99.5 myosin phosphat...
Pan troglodytes
CAI24302 0 75.6 myosin phosphat...
Mus musculus
CAI24299 2.5e-124 85.1 myosin phosphat...
Mus musculus
XP_536669 1.4e-105 78.9 similar to myos...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051449 1.5e-18 45.0 KIAA1662
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GGCTGTTAAGAGGAGAAAGTG
Primer_r GAAAGGTTTGCCACGACTCTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f GGCTGTTAAGAGGAGAAAGTG
Primer_r GAAAGGTTTGCCACGACTCTC
PCR product length 115 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp