Gene/Protein Characteristic Table for KIAA0872
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK02001
Accession No AB020679
Description MON1 secretory trafficking family member B, transcript variant 1
Clone name hk07213
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4118 bp)
Predicted protein sequence (552 aa)
Flexi ORF Clone FXC02001
Source Human adult brain
Rouge ID mKIAA0872 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4118 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 552 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q7L1V2 2.9e-191 100.0 Vacuolar fusion...
Homo sapiens
BAG51238 9e-191 99.8 unnamed protein...
Homo sapiens
XP_001105175 2.1e-187 97.5 similar to MON1...
Macaca mulatta
Q4R4E4 1.3e-185 97.4 Vacuolar fusion...
Macaca fascicularis
XP_546825 4.3e-169 88.4 similar to MON1...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR004353 115 132 PR01546 Protein of unknown function DUF254
IPR004353 133 153 PR01546 Protein of unknown function DUF254
IPR004353 167 181 PR01546 Protein of unknown function DUF254
IPR004353 190 218 PR01546 Protein of unknown function DUF254
IPR004353 219 231 PR01546 Protein of unknown function DUF254
IPR004353 249 270 PR01546 Protein of unknown function DUF254
IPR004353 273 286 PR01546 Protein of unknown function DUF254
IPR004353 301 317 PR01546 Protein of unknown function DUF254
IPR004353 325 348 PR01546 Protein of unknown function DUF254
IPR004353 354 380 PR01546 Protein of unknown function DUF254
IPR004353 483 497 PR01546 Protein of unknown function DUF254
IPR004353 499 512 PR01546 Protein of unknown function DUF254
IPR004353 512 532 PR01546 Protein of unknown function DUF254
HMMPfam IPR004353 104 532 PF03164 Protein of unknown function DUF254
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCAGCCACCCCTTATTAACAG
Primer_r CTGGAGAAAAGAGGCTGTGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp