KIAA1873

Gene/Protein Characteristic Table for KIAA1873

Order Kazusa clone(s) from :

Product ID	ORK04434
Accession No	AB058776
Description	caprin family member 2
Clone name	hk07219
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3970 bp) Predicted protein sequence (477 aa)
Source	Human adult brain
Rouge ID	mKIAA1873 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3970 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2536 bp
Genome contig ID	gi89161190r_30653755
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATGCCTTGTTGTGCCTCAATAAAAAAGTTACATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTCAGTGTTCCTATTTAATTAAACATTTAGTTGAGAGGTAAAATATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	30753755	30775649	13	100.0	Internal No-hit

Features of the protein sequence

Description

Length: 477 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI17674	3.4e-141	99.6	CAPRIN2 protein...	Homo sapiens
EAW96608	1.4e-118	99.5	C1q domain cont...	Homo sapiens
AAI17673	1.5e-109	92.5	CAPRIN2 protein...	Homo sapiens
DAA01120	1.7e-109	92.5	TPA_exp: cytopl...	Homo sapiens
Q6IMN6	1.7e-109	92.5	Caprin-2; Cytop...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TAAATTGTGATGTAGCCTCGC
Primer_r	ATTGTAACTTGCCTGGACTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 12

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp