|
Order Kazusa clone(s) from : |
| Product ID | ORK00142 |
|---|---|
| Accession No | AB020686 |
| Description | ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) |
| Clone name | hk07371 |
| Vector information | |
| cDNA sequence | DNA sequence (4312 bp) Predicted protein sequence (461 aa) |
|
HaloTag ORF Clone |
FHC00142
|
| Flexi ORF Clone | FXC00142 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0879
by Kazusa Mouse cDNA Project
|
Length: 4312 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2902 bp |
|---|---|
| Genome contig ID | gi89161210f_46115246 |
| PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (106993 - 107042) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 6 | f | 46205871 | 46222237 | 4 | 99.2 | Perfect prediction |
Length: 461 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR002591 | 34 | 347 | PF01663 | Type I phosphodiesterase/nucleotide pyrophosphatase |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 3 | SFNVFIMKLLVILLFSGLITGFR | 25 | PRIMARY | 23 | 2 | 412 | LPEAIAIVIGSLLVLTMLTCLII | 434 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TTGGGTGTCTCCTTCTTGTGC |
|---|---|
| Primer_r | TACACATTTTCCATCTCCTCC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 6
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TTGGGTGTCTCCTTCTTGTGC |
| Primer_r | TACACATTTTCCATCTCCTCC |
| PCR product length | 139 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |