KIAA0684

Product ID	ORK07268
Accession No	AB014584
Description	ubiquitination factor E4B
Clone name	hk07567
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4161 bp) Predicted protein sequence (1218 aa)
Source	Human adult brain
Rouge ID	mKIAA0684 by Kazusa Mouse cDNA Project
Note	We replaced hk02956, former representative clones for KIAA0684 with hk07567. (2003/8/28)

Length: 4161 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	60 bp
Genome contig ID	gi89161185f_9915737
PolyA signal sequence (None)	+--------+--------+----*----+---- AGACACAGCCAAGGCCAACGAGGCAAGCAGAAGCA
Flanking genome sequence (246926 - 246975)	----+--------+--------+--------+--------+----* GCGGCCGCAGCGAAGCTGCCGTTCATGTGTTGGAGGCCAAATGTGGCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	10015737	10162661	27	100.0	Perfect prediction

Length: 1218 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK69622	100.0	ubiquitin-fusio...	Homo sapiens
BAF85133	99.9	unnamed protein...	Homo sapiens
XP_001161612	99.8	ubiquitination ...	Pan troglodytes
XP_001101932	99.7	ubiquitination ...	Macaca mulatta
XP_001915350	98.6	ubiquitination ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50916	4.6e-24	27.3	KIAA0126

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003613	1143	1216	PF04564	U box
HMMSmart	IPR003613	1147	1209	SM00504	U box
ScanRegExp	IPR006162	307	322	PS00012	Phosphopantetheine attachment site

Primer_f	TGACGACCAGAGATCCTACAG
Primer_r	TGTAGTCGATTTCTGCGCGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCATCATCCTGCGGCACCTG
Primer_r	CATCCACGCCTGAATCTGCTC
PCR product length	117 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles