KIAA0895

Gene/Protein Characteristic Table for KIAA0895

Order Kazusa clone(s) from :

Product ID	ORK00677
Accession No	AB020702
Description	KIAA0895, transcript variant 2
Clone name	hk08826
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4155 bp) Predicted protein sequence (540 aa)
HaloTag ORF Clone	FHC00677
Flexi ORF Clone	FXC00677
Source	Human adult brain
Rouge ID	mKIAA0895 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4155 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2530 bp
Genome contig ID	gi89161213r_36230364
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTGTCTAGCTATAATAAAAAGAAACGGTGCCAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTTCTCAGATGAAGTGTGTGGCTATGTATGCATGTAACTTGGTTTCTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	36330364	36373289	6	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 540 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_056129	6.9e-194	99.8	hypothetical pr...	Homo sapiens
XP_001500267	2e-176	92.5	hypothetical pr...	Equus caballus
EDL78216	6e-169	87.3	similar to RIKE...	Rattus norvegicus
EDL25276	6.6e-167	85.1	RIKEN cDNA 9530...	Mus musculus
BAG57296	1.3e-93	88.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TATGTCCTGTGATTCAAGCCC
Primer_r	AGAACTGCTGCAAATGATCCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 7

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp