Gene/Protein Characteristic Table for KIAA1006
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK02011
Accession No AB023223
Description syntaxin binding protein 5-like, transcript variant 1
Clone name hk10084
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4370 bp)
Predicted protein sequence (1221 aa)
Flexi ORF Clone FXC02011
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4370 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 702 bp
Genome contig ID gi89161205f_122009773
PolyA signal sequence
(AGTAAA,-19)
+----*----+----*----+----*----+----
CAAATATTGCCAGTATAGTAAATTATTCCCAACAC
Flanking genome sequence
(611565 - 611614)
----+----*----+----*----+----*----+----*----+----*
AATCAGTTTCATTTCTATCACCTTCAGAATGGGTTGCTGTTTTTAGCACA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 3 f 122109773 122621336 28 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 1221 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_516678 0 100.0 syntaxin bindin...
Pan troglodytes
EAW79517 0 100.0 hCG16779, isofo...
Homo sapiens
Q9Y2K9 0 100.0 Syntaxin-bindin...
Homo sapiens
XP_001070379 0 95.0 similar to Synt...
Rattus norvegicus
XP_001500511 0 97.7 syntaxin bindin...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051432 0.00033 23.9 KIAA1645
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000664 88 106 PR00962 Lethal(2) giant larvae protein
IPR001680 161 175 PR00320 WD40 repeat
IPR001680 259 273 PR00320 WD40 repeat
IPR000664 356 378 PR00962 Lethal(2) giant larvae protein
IPR000664 408 428 PR00962 Lethal(2) giant larvae protein
IPR000664 496 519 PR00962 Lethal(2) giant larvae protein
IPR001680 499 513 PR00320 WD40 repeat
IPR000664 679 703 PR00962 Lethal(2) giant larvae protein
HMMPfam IPR001680 287 313 PF00400 WD40 repeat
IPR013577 320 432 PF08366 Lethal giant larvae homologue 2
IPR001680 434 512 PF00400 WD40 repeat
HMMSmart IPR001680 94 133 SM00320 WD40 repeat
IPR001680 135 174 SM00320 WD40 repeat
IPR001680 233 272 SM00320 WD40 repeat
IPR001680 276 313 SM00320 WD40 repeat
IPR001680 433 512 SM00320 WD40 repeat
IPR001680 537 577 SM00320 WD40 repeat
ProfileScan IPR001680 142 183 PS50082 WD40 repeat
IPR001680 142 322 PS50294 WD40 repeat
IPR001680 281 322 PS50082 WD40 repeat
IPR001388 1156 1216 PS50892 Synaptobrevin
ScanRegExp IPR001680 161 175 PS00678 WD40 repeat
IPR001680 259 273 PS00678 WD40 repeat
IPR001680 499 513 PS00678 WD40 repeat
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACGGGGAGTCCTCTTGATTTG
Primer_r TGAGTGTGGCCCAATTGATAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f ACGGGGAGTCCTCTTGATTTG
Primer_r TGAGTGTGGCCCAATTGATAG
PCR product length 176 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp