KIAA1719

Product ID	ORK00898
Accession No	AB051506
Description	glutamate receptor interacting protein 2
Clone name	pf00330s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7706 bp) Predicted protein sequence (1050 aa)
HaloTag ORF Clone	FHC00898
Flexi ORF Clone	FXC00898
Source	Human brain (hippocampus)
Note	We replaced pf00330, former representative clones for KIAA1719 with pf00330s1. (2002/5/10)

Length: 7706 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4553 bp
Genome contig ID	gi89161205r_14405623
PolyA signal sequence (AATACA,-21)	+--------+--------+----*----+---- AAGGATCTTGTTCAAATACAAATGTTCCTCCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGTCTCTTGTTGGTTGATTTTTTTTTTATAAAAGTTTAAAATATCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	14505623	14556840	24	99.3	Perfect prediction

Length: 1050 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073892	99.5	glutamate recep...	Homo sapiens
Q9C0E4	100.0	Glutamate recep...	Homo sapiens
EAW64198	99.9	hCG27236, isofo...	Homo sapiens
XP_001090379	97.2	glutamate recep...	Macaca mulatta
XP_541752	92.4	similar to Glut...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	55	135	PF00595	PDZ/DHR/GLGF
	IPR001478	155	238	PF00595	PDZ/DHR/GLGF
	IPR001478	255	336	PF00595	PDZ/DHR/GLGF
	IPR001478	463	549	PF00595	PDZ/DHR/GLGF
	IPR001478	564	645	PF00595	PDZ/DHR/GLGF
	IPR001478	663	742	PF00595	PDZ/DHR/GLGF
	IPR001478	948	1027	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	64	138	SM00228	PDZ/DHR/GLGF
	IPR001478	163	241	SM00228	PDZ/DHR/GLGF
	IPR001478	264	339	SM00228	PDZ/DHR/GLGF
	IPR001478	472	552	SM00228	PDZ/DHR/GLGF
	IPR001478	573	648	SM00228	PDZ/DHR/GLGF
	IPR001478	671	745	SM00228	PDZ/DHR/GLGF
	IPR001478	958	1030	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	55	138	PS50106	PDZ/DHR/GLGF
	IPR001478	155	241	PS50106	PDZ/DHR/GLGF
	IPR001478	255	339	PS50106	PDZ/DHR/GLGF
	IPR001478	463	538	PS50106	PDZ/DHR/GLGF
	IPR001478	564	648	PS50106	PDZ/DHR/GLGF
	IPR001478	663	745	PS50106	PDZ/DHR/GLGF
	IPR001478	948	1030	PS50106	PDZ/DHR/GLGF

Primer_f	CCTGCCCTAGTTGGAGTGACA
Primer_r	GTGCTCCCTACATCTTCGACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CCTGCCCTAGTTGGAGTGACA
Primer_r	GTGCTCCCTACATCTTCGACC
PCR product length	177 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles