KIAA0629

Product ID	ORK04072
Accession No	AB014529
Description	A kinase (PRKA) anchor protein 11
Clone name	pf00524
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7855 bp) Predicted protein sequence (1272 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA0629 by Kazusa Mouse cDNA Project
Note	We replaced hh01672, former representative clones for KIAA0629 with pf00524. (2002/5/10)

Length: 7855 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4034 bp
Genome contig ID	gi51511729f_41672768
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTAAGAGTTCTTCAATAAATTTAAGAAATACCTGG
Flanking genome sequence (122636 - 122685)	----+--------+--------+--------+--------+----* TCTTGGTTTTCATTCTATAATATCTCATTAACTGCTCTGTACTGAGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	41772768	41795402	6	99.0	Perfect prediction

Length: 1272 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKA4	100.0	A-kinase anchor...	Homo sapiens
XP_001151723	98.5	A-kinase anchor...	Pan troglodytes
XP_001091086	94.2	A-kinase anchor...	Macaca mulatta
XP_001151787	96.3	A-kinase anchor...	Pan troglodytes
XP_001492688	81.1	similar to A-ki...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051465	1.7e-07	23.1	KIAA1678

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008382	1196	1272	PF05716	A-kinase anchor 110 kDa

Primer_f	AAAACCCTGTCCACCTGTCAC
Primer_r	AGGAGTCTTGCTGAAAATGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAAACCCTGTCCACCTGTCAC
Primer_r	AGGAGTCTTGCTGAAAATGAG
PCR product length	109 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles