KIAA1147

Product ID	ORK00188
Accession No	AB032973
Description	KIAA1147
Clone name	pf02131
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7282 bp) Predicted protein sequence (451 aa)
HaloTag ORF Clone	FHC00188
Flexi ORF Clone	FXC00188
Source	Human brain (hippocampus)
Rouge ID	mKIAA1147 by Kazusa Mouse cDNA Project
Note	We replaced hg00388, former representative clones for KIAA1147 with pf02131. (2005/08/06)

Length: 7282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5925 bp
Genome contig ID	gi89161213r_140902999
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- ATGATTTTTACAATTAAAGTTCACATTTTAACATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACGTGCGTGCTGCAATCCCTTCTCCAGTCCGAGAAATGTGGTTTGTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	141002999	141048411	9	99.1	Perfect prediction

Length: 451 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q0PGW2	4.3e-177	96.5	Protein LCHN.	Rattus norvegicus
EDM15407	4.7e-177	96.5	similar to RIKE...	Rattus norvegicus
XP_001083728	8.8e-177	96.2	hypothetical pr...	Macaca mulatta
Q3UHG7	2.4e-176	96.2	Protein LCHN.	Mus musculus
EDL13586	2.7e-176	96.2	RIKEN cDNA E330...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	261	PPVGVVCYRVYCCCCLANVSLPG	283	PRIMARY	23

Primer_f	GACAGGTCTAACATGGGCAAG
Primer_r	TTCTCACCTCGGTCTAACTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-