KIAA0553

Product ID	ORK01091
Accession No	AB011125
Description	G patch domain containing 8, transcript variant 3
Clone name	pf08859
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8115 bp) Predicted protein sequence (1450 aa)
Flexi ORF Clone	FXC01091
Source	Human brain (hippocampus)
Rouge ID	mKIAA0553 by Kazusa Mouse cDNA Project
Note	We replaced hh00875, former representative clones for KIAA0553 with pf08859. (1998/4/10)

Length: 8115 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2284 bp
Genome contig ID	gi51511734r_39728178
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GGAAAGGAACTTTCTAATAAACCAATGATTTGTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTAGCAGAGTCTGTCGTAATTGTTGCCCCATCCACTCAAAGTTAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	39828178	39898829	7	99.1	Perfect prediction

Length: 1450 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001002909	99.7	G patch domain ...	Homo sapiens
XP_001150098	99.2	hypothetical pr...	Pan troglodytes
XP_001150301	99.2	hypothetical pr...	Pan troglodytes
XP_001149918	99.6	hypothetical pr...	Pan troglodytes
XP_001114589	98.3	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	1.9e-06	24.7	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR007087	84	113	PS50157	Zinc finger
ScanRegExp	IPR007087	86	108	PS00028	Zinc finger

Primer_f	GGGTGGGAGGGCAGTCAAGAG
Primer_r	GCTAGAATTGGTTGGTTGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGGTGGGAGGGCAGTCAAGAG
Primer_r	GCTAGAATTGGTTGGTTGGTC
PCR product length	128 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles