KIAA0714

Product ID	ORK01113
Accession No	AB018257
Description	listerin E3 ubiquitin protein ligase 1
Clone name	pf12310
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7650 bp) Predicted protein sequence (1780 aa)
HaloTag ORF Clone	FHC01113
Flexi ORF Clone	FXC01113
Source	Human brain (hippocampus)
Rouge ID	mKIAA0714 by Kazusa Mouse cDNA Project
Note	We replaced hj00574, former representative clones for KIAA0714 with pf12310. (2005/08/06)

Length: 7650 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2307 bp
Genome contig ID	gi51511750r_29122345
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTCTGATTTTTAAATAAATAAAATGTTACTCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTACTTCTCCCTGGCGCCATTCTCCTCCTTCTTTCCCTAGAGCTAACGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	r	29222345	29287039	30	99.6	Perfect prediction

Length: 1780 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_514851	99.4	zinc finger pro...	Pan troglodytes
O94822	100.0	Zinc finger pro...	Homo sapiens
AAI40791	99.9	Zinc finger pro...	Homo sapiens
XP_001103642	97.8	similar to zinc...	Macaca mulatta
XP_001915227	91.8	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	1751	1775	PF00097	Zinc finger
HMMSmart	IPR011016	1728	1776	SM00744	Zinc finger
ProfileScan	IPR001841	1729	1776	PS50089	Zinc finger

Primer_f	AAGGTGCCTCCATTTATCAAG
Primer_r	TAACTACCACTCCGCTTCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCAAACTGAGCTATTCTTACC
Primer_r	TTAAGAGTGGCAAAAGGCAGG
PCR product length	167 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles