KIAA1236

Product ID	ORK05753
Accession No	AB033062
Description	kinesin family member 26A
Clone name	pg00641
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6627 bp) Predicted protein sequence (1840 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1236 by Kazusa Mouse cDNA Project
Note	We replaced fh08822, former representative clones for KIAA1236 with pg00641. (2002/5/10)

Length: 6627 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1104 bp
Genome contig ID	gi51511730f_103575217
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GCTTTTATTTGTGAATTAAAGATGCATCGATGGTT
Flanking genome sequence (141769 - 141818)	----+--------+--------+--------+--------+----* CCCACGGCTGCCGAGTTCACTGGGCGTCGGCAGACTCCTCACGCCCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	103675217	103716984	14	100.0	Perfect prediction

Length: 1840 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06715	100.0	KIF26A variant ...	Homo sapiens
Q9ULI4	100.0	Kinesin-like pr...	Homo sapiens
EAW81861	100.0	hCG22909, isofo...	Homo sapiens
EAW81860	99.9	hCG22909, isofo...	Homo sapiens
Q52KG5	77.6	Kinesin-like pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26361	0.00079	29.7	KIAA0042

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	418	439	PR00380	Kinesin
	IPR001752	587	605	PR00380	Kinesin
	IPR001752	632	653	PR00380	Kinesin
HMMPfam	IPR001752	335	684	PF00225	Kinesin
HMMSmart	IPR001752	327	691	SM00129	Kinesin
ProfileScan	IPR001752	326	608	PS50067	Kinesin

Primer_f	TTGCCGTGGGAATTTGAAGAC
Primer_r	AAGTATGAGCCTGTCGTGCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTGCCGTGGGAATTTGAAGAC
Primer_r	AAGTATGAGCCTGTCGTGCGG
PCR product length	216 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles