KIAA1734

Product ID	ORK01635
Accession No	AB051521
Description	ubiquitin-conjugating enzyme E2O
Clone name	ph00331
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5073 bp) Predicted protein sequence (1313 aa)
HaloTag ORF Clone	FHC01635
Flexi ORF Clone	FXC01635
Source	Human brain (hippocampus)
Rouge ID	mKIAA1734 by Kazusa Mouse cDNA Project

Length: 5073 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1129 bp
Genome contig ID	gi51511734r_71797491
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAAACTCAAAAGCAAAGATATTAACTCTTATTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGACAAAAAAAAAGCCAAAGCATGATGCGTCTTGTCAGCCTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	71897491	71960883	18	99.5	Perfect prediction

Length: 1313 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001099166	99.0	similar to ubiq...	Macaca mulatta
BAG10135	100.0	ubiquitin-conju...	synthetic construct
Q9C0C9	99.8	Ubiquitin-conju...	Homo sapiens
EAW89399	99.8	ubiquitin-conju...	Homo sapiens
EAW89398	99.5	ubiquitin-conju...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033115	4.6e-11	31.8	KIAA1289

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000608	981	1098	PD000461	Ubiquitin-conjugating enzyme
HMMPfam	IPR000608	978	1127	PF00179	Ubiquitin-conjugating enzyme
HMMSmart	IPR000608	977	1134	SM00212	Ubiquitin-conjugating enzyme
ProfileScan	IPR000608	977	1098	PS50127	Ubiquitin-conjugating enzyme

Primer_f	CTACCGGAGCTTCTTACCTGA
Primer_r	TACTTGTCCTCTGTGCACTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-