KIAA1736

Product ID	ORK00906
Accession No	AB051523
Description	autophagy/beclin-1 regulator 1, transcript variant 4
Clone name	ph00725
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5067 bp) Predicted protein sequence (1244 aa)
HaloTag ORF Clone	FHC00906
Flexi ORF Clone	FXC00906
Source	Human brain (hippocampus)
Rouge ID	mKIAA1736 by Kazusa Mouse cDNA Project

Length: 5067 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1036 bp
Genome contig ID	gi51511727r_46274540
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AAAGATCACATCATTAAAATGATGACATGCCCCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCCAGGCTCCTCTCTCTTATTTCCAAGGAGGATGGGGGAGGGGTGGGGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	46374540	46572147	17	100.0	Perfect prediction

Length: 1244 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM14520	95.5	autophagy/becli...	Mus musculus
XP_001163387	92.6	hypothetical pr...	Pan troglodytes
Q9C0C7	95.4	Activating mole...	Homo sapiens
BAG64009	95.3	unnamed protein...	Homo sapiens
XP_001112256	94.4	similar to WD r...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	100	131	PD000018	WD40 repeat
HMMPfam	IPR001680	91	130	PF00400	WD40 repeat
HMMSmart	IPR001680	56	87	SM00320	WD40 repeat
	IPR001680	90	130	SM00320	WD40 repeat
	IPR001680	132	170	SM00320	WD40 repeat
ProfileScan	IPR001680	55	139	PS50294	WD40 repeat
ProfileScan	IPR001680	97	131	PS50082	WD40 repeat
ScanRegExp	IPR001680	117	131	PS00678	WD40 repeat

Primer_f	GTCTTCACTGTCCATTCCAAC
Primer_r	TCCCTCTCAGTCTGTGTTTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-