KIAA1814

Product ID	ORK04826
Accession No	AB058717
Description	DOT1-like histone H3K79 methyltransferase
Clone name	ph00952
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5576 bp) Predicted protein sequence (1285 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1814 by Kazusa Mouse cDNA Project

Length: 5576 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1661 bp
Genome contig ID	gi42406306f_2061699
PolyA signal sequence (GATAAA,-22)	+--------+--------+----*----+---- GTCGATAGTTTTAGATAAAGTATTTATCATTTTTT
Flanking genome sequence (119310 - 119359)	----+--------+--------+--------+--------+----* AAAAAGTATAAACAATTCTGACTTATTTTATTCCATCTAAGTGGTAAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	2161699	2181007	15	100.0	Perfect prediction

Length: 1285 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW69409	99.8	DOT1-like, hist...	Homo sapiens
Q8TEK3	99.8	Histone-lysine ...	Homo sapiens
XP_001097213	97.0	DOT1-like, hist...	Macaca mulatta
BAB84946	99.1	FLJ00192 protei...	Homo sapiens
AAM88322	99.9	DOT1-like prote...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GTAGGGTGGCTTTAGCTGGAC
Primer_r	CAGCTCCTCTAACCACAACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 19

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTAGGGTGGCTTTAGCTGGAC
Primer_r	CAGCTCCTCTAACCACAACAG
PCR product length	95 bp
PCR conditions	15 °C66 sec60 °C30 sec134 cycles