KIAA1747

Product ID	ORK00276
Accession No	AB051534
Description	bone morphogenetic protein/retinoic acid inducible neural-specific 2
Clone name	pj02023
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3654 bp) Predicted protein sequence (791 aa)
HaloTag ORF Clone	FHC00276
Flexi ORF Clone	FXC00276
Source	Human brain (hippocampus)
Rouge ID	mKIAA1747 by Kazusa Mouse cDNA Project

Length: 3654 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	888 bp
Genome contig ID	gi89161185f_175307154
PolyA signal sequence (AGTAAA,-20)	+--------+--------+----*----+---- CCACCTGAACATCTAAGTAAACATTTATCTGGTTT
Flanking genome sequence (211023 - 211072)	----+--------+--------+--------+--------+----* AATATATTTTTGGAAAAGGCCTTTTTTAGGGGGAAAAATGAGAGAAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	175407154	175518175	8	99.4	Perfect prediction

Length: 791 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0B6	100.0	Protein FAM5B; ...	Homo sapiens
XP_001153444	99.7	BMP/retinoic ac...	Pan troglodytes
XP_001105463	99.6	similar to BMP/...	Macaca mulatta
CAA22893	100.0	hypothetical pr...	Homo sapiens
Q5RDR5	99.2	Protein FAM5B; ...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001862	144	182	PF01823	Membrane attack complex component/perforin/complement C9
HMMSmart	IPR001862	97	289	SM00457	Membrane attack complex component/perforin/complement C9

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	24	VAPWTALLALGLPGWVLAVSATA	46	PRIMARY	23

Primer_f	TCCTTTCCAACAGCATCTCTC
Primer_r	CTTAGATGTTCAGGTGGTTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-