Order Kazusa clone(s) from : ![]() |
Product ID | ORK00276 |
---|---|
Accession No | AB051534 |
Description | bone morphogenetic protein/retinoic acid inducible neural-specific 2 |
Clone name | pj02023 |
Vector information | |
cDNA sequence | DNA sequence (3654 bp) Predicted protein sequence (791 aa) |
HaloTag ORF Clone |
FHC00276
![]() |
Flexi ORF Clone | FXC00276 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1747
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 888 bp |
---|---|
Genome contig ID | gi89161185f_175307154 |
PolyA signal sequence (AGTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (211023 - 211072) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 175407154 | 175518175 | 8 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001862 | 144 | 182 | PF01823 | Membrane attack complex component/perforin/complement C9 |
HMMSmart | IPR001862 | 97 | 289 | SM00457 | Membrane attack complex component/perforin/complement C9 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 24 | VAPWTALLALGLPGWVLAVSATA | 46 | PRIMARY | 23 |
---|
![]() |
Primer_f | TCCTTTCCAACAGCATCTCTC |
---|---|
Primer_r | CTTAGATGTTCAGGTGGTTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |