HUGE

Gene/Protein Characteristic Table for KIAA0003

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01948
Accession No. :	D13628
Description :	Angiopoietin-1 precursor.
HUGO Gene Name :	angiopoietin 1 (ANGPT1)
Clone Name :	hk04939 [Vector Info]
Flexi ORF Clone :	pF1KA0003
Source :	Human adult brain
Note :	We replaced ha00055, former representative clones for KIAA0003 with hk04939. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 4211 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2363 bp

Genome contig ID gi51511724r_108230896
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CAACATTATTTGATTTAAATAAAATTGAAAGTAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTGTGCAACTTCATTTTATTTTTAATACGTATTTTGCCAAATTTAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 108330896 108579313 9 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 524 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15389	1.5e-189	100.0	Angiopoietin-1;...	Homo sapiens
XP_001088871	3.3e-189	99.8	angiopoietin 1 ...	Macaca mulatta
BAB91325	2.2e-188	99.8	angiopoietin-1 ...	Homo sapiens
XP_001494996	1.1e-186	98.0	similar to Angi...	Equus caballus
O08538	2.2e-186	97.6	Angiopoietin-1;...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002181 310 522 PF00147 Fibrinogen

HMMSmart IPR002181 307 522 SM00186 Fibrinogen

ScanRegExp IPR002181 473 485 PS00514 Fibrinogen

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002181	310	522	PF00147	Fibrinogen
HMMSmart	IPR002181	307	522	SM00186	Fibrinogen
ScanRegExp	IPR002181	473	485	PS00514	Fibrinogen

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGTGTCCAAGGTTATGACAG
Primer_r	: GTTTGAAACTGGTATTGCTA
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec56 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2363 bp
Genome contig ID	gi51511724r_108230896
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CAACATTATTTGATTTAAATAAAATTGAAAGTAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGTGCAACTTCATTTTATTTTTAATACGTATTTTGCCAAATTTAAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	108330896	108579313	9	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0003

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information