HUGE |
Gene/Protein Characteristic Table for KIAA0011 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01950 |
---|---|
Accession No. : | D13636 |
Description : | General transcription factor 3C polypeptide 2. |
HUGO Gene Name : | general transcription factor IIIC, polypeptide 2, beta 110kDa (GTF3C2) |
Clone Name : | ha00409 [Vector Info] |
Flexi ORF Clone : | pF1KA0011
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3594 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 819 bp Genome contig ID gi89161199r_27302227 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
AAATCTTCTCTAGATTAAATATCTTCAGTTACTTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACCATTCTTTTACACGTCATGATTTTTGATCCTTCATGATACTGTCACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 27402227 27433124 19 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 924 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 2 |
: Genebridge 4 | |
: TTGGGGGGTGCTGATGGATAC | |
: CTGATTTAGCACCTCTTGTCC | |
: 112 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |