HUGE

Gene/Protein Characteristic Table for KIAA0014

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00363
Accession No. :	D25216
Description :	Leucine-rich repeat-containing protein 14.
HUGO Gene Name :	leucine rich repeat containing 14 (LRRC14)
Clone Name :	ha00442 [Vector Info]
Flexi ORF Clone :	pF1KSDA0014
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5323 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3695 bp

Genome contig ID gi51511724f_145615806
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
GAAACTAATAAAACGTTCTGGTTTTCTCCTTTGAC
Flanking genome sequence
(105561 - 105610)
----+----*----+----*----+----*----+----*----+----*
AAAAACATTTTCTTAAAGCTCTGGGGCATCAGGTTCAAATTTAGAATTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 145714199 145721365 4 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 513 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15048	1.3e-209	100.0	Leucine-rich re...	Homo sapiens
BAF82162	3.3e-209	99.8	unnamed protein...	Homo sapiens
XP_001094307	5.2e-207	98.8	leucine rich re...	Macaca mulatta
XP_539223	1.2e-203	95.4	similar to Leuc...	Canis lupus fam...
XP_001926063	3.8e-201	96.1	similar to MGC1...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 358 371 PR00019 Leucine-rich repeat

IPR001611 412 425 PR00019 Leucine-rich repeat

HMMPfam IPR001611 357 379 PF00560 Leucine-rich repeat

ScanRegExp IPR000209 140 150 PS00136 Peptidase S8 and S53

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	358	371	PR00019	Leucine-rich repeat
IPR001611	412	425	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	357	379	PF00560	Leucine-rich repeat
ScanRegExp	IPR000209	140	150	PS00136	Peptidase S8 and S53

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CAGCAGCAGCGGCAGCAGTT
Primer_r	: CATCTATTGGCTGGCTCTCG
PCR product length	: 152 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3695 bp
Genome contig ID	gi51511724f_145615806
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- GAAACTAATAAAACGTTCTGGTTTTCTCCTTTGAC
Flanking genome sequence (105561 - 105610)	----+--------+--------+--------+--------+----* AAAAACATTTTCTTAAAGCTCTGGGGCATCAGGTTCAAATTTAGAATTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	145714199	145721365	4	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0014

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information