| HUGE |
Gene/Protein Characteristic Table for KIAA0015 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00003 |
|---|---|
| Accession No. : | D13640 |
| Description : | Protein phosphatase 1F. |
| HUGO Gene Name : | protein phosphatase 1F (PP2C domain containing) (PPM1F) |
| Clone Name : | ha00478 [Vector Info] |
| Flexi ORF Clone : | pF1KA0015
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5134 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3663 bp Genome contig ID gi89161203r_20503800 PolyA signal sequence
(AATAAA,-18)
CACCATGCAGAAGTGTCAATAAACCACAAGTTCTGFlanking genome sequence
(100000 - 99951)
AACTCTGTCGCCCGAGTCCTGCCTTCTTCCTGACTTCTGAGCATCTTGTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 20603800 20637209 8 99.2 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 480 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 22 |
| : Genebridge 4 | |
| : CTCCTCTCCTCTCCTATGGT | |
| : AGGCAGAATCAAACCAAAAA | |
| : 170 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
