HUGE |
Gene/Protein Characteristic Table for KIAA0018 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00004 |
---|---|
Accession No. : | D13643 |
Description : | 24-dehydrocholesterol reductase precursor. |
HUGO Gene Name : | 24-dehydrocholesterol reductase (DHCR24) |
Clone Name : | hk07284 [Vector Info] |
Flexi ORF Clone : | pF1KA0018 |
Source : | Human adult brain |
Note : | We replaced ha00517, former representative clones for KIAA0018 with hk07284. (2001/10/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4268 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2605 bp Genome contig ID gi89161185r_54987889 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TGCTTCTGTTTAAATAAAAGTGGCCTGGAAGCTGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CGTTTGTCGTTTCTTGCTTGGGGGACCAAAATGTGGAGTCAGATCTGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 55087889 55125493 9 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 553 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 1 |
: Genebridge 4 | |
: TTGGCCAGAAGGATGAATAC | |
: AGTGCCTGTGGCTGTAAGAG | |
: 156 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |