HUGE

Gene/Protein Characteristic Table for KIAA0025

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00371
Accession No. :	D14695
Description :	Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein.
HUGO Gene Name :	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 (HERPUD1)
Clone Name :	ha00594 [Vector Info]
Flexi ORF Clone :	pF1KSDA0025
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1860 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 591 bp

Genome contig ID gi51511732f_55423565
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TTCTGTTCAATAAAGTTTTACTATGAATGACCCTG
Flanking genome sequence
(111731 - 111780)
----+----*----+----*----+----*----+----*----+----*
GCAGAGACTCCTGTCATCCTAGCAGTTTACTCTGCGTTTGTTGTATCTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 55523565 55535294 8 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 422 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW82893	2.9e-163	99.8	homocysteine-in...	Homo sapiens
BAF84254	2.1e-151	99.7	unnamed protein...	Homo sapiens
BAD96953	2.1e-151	99.7	homocysteine-in...	Homo sapiens
BAF84777	2.4e-151	99.7	unnamed protein...	Homo sapiens
NP_001010989	1.4e-150	99.7	homocysteine-in...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000626 46 120 PF00240 Ubiquitin

HMMSmart IPR000626 41 118 SM00213 Ubiquitin

ProfileScan IPR000626 41 103 PS50053 Ubiquitin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000626	46	120	PF00240	Ubiquitin
HMMSmart	IPR000626	41	118	SM00213	Ubiquitin
ProfileScan	IPR000626	41	103	PS50053	Ubiquitin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 316 SSLSRFLMVMGATVVMYLHHVGW 338 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	316	SSLSRFLMVMGATVVMYLHHVGW	338	PRIMARY	23

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GGCTTTGACAGGAATGGACT
Primer_r	: ATTTGTATCACGGCTTCACG
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	591 bp
Genome contig ID	gi51511732f_55423565
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TTCTGTTCAATAAAGTTTTACTATGAATGACCCTG
Flanking genome sequence (111731 - 111780)	----+--------+--------+--------+--------+----* GCAGAGACTCCTGTCATCCTAGCAGTTTACTCTGCGTTTGTTGTATCTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	55523565	55535294	8	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0025

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information