HUGE |
Gene/Protein Characteristic Table for KIAA0027 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00373 |
---|---|
Accession No. : | D25217 |
Description : | Membrane protein MLC1. |
HUGO Gene Name : | megalencephalic leukoencephalopathy with subcortical cysts 1 (MLC1) |
Clone Name : | fk03155 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0027 |
Source : | Human fetal brain |
Note : | We replaced ha00522, former representative clones for KIAA0027 with fk03155. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3629 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2185 bp Genome contig ID gi89161203r_48739954 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
TGTTTAATACGCTTGAGCAATAAACGCTGACTTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGACGTGGCTGTGGCTATTTAATATTGTGTCTCAGCAGCGTCAGCTCACT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 48839954 48866161 12 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 418 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
Northern blot | Description |
---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: Genebridge 4 | |
: TCAGGGGCCGGGCAAACACT | |
: CTCAAAGCTGCAGGGAGGTG | |
: 363 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |