HUGE

Gene/Protein Characteristic Table for KIAA0038

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01656
Accession No. :	D26068
Description :	Eukaryotic translation initiation factor 4H.
HUGO Gene Name :	eukaryotic translation initiation factor 4H (EIF4H)
Clone Name :	ha01502 [Vector Info]
Flexi ORF Clone :	pF1KA0038
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2477 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1782 bp

Genome contig ID gi89161213f_73126642
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTGAATGATCTTTTAAATAAAAGAAAACCTTACGT
Flanking genome sequence
(122718 - 122767)
----+----*----+----*----+----*----+----*----+----*
AATATTTAATGCTTGCCTTTATTTTTGAGTTCTTTTTAGCTGCTCATGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 73226642 73249358 6 99.2 Perfect prediction

ContigView(URL based/DAS) 7 r 27462523 27465001 1 98.0 Perfect prediction

Features of the protein sequence	Description

Length: 230 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF75557	5.4e-88	100.0	wbscr1 [Homo sa...	Homo sapiens
BAE89020	6.2e-88	99.6	unnamed protein...	Macaca fascicularis
XP_527788	1.4e-87	99.6	similar to Wbsc...	Pan troglodytes
AAD34860	1.9e-87	99.1	Wbscr1 alternat...	Mus musculus
Q1JPH6	2.9e-87	99.1	Eukaryotic tran...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 46 115 PF00076 RNA recognition motif

HMMSmart IPR000504 45 116 SM00360 RNA recognition motif

ProfileScan IPR000504 44 120 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	46	115	PF00076	RNA recognition motif
HMMSmart	IPR000504	45	116	SM00360	RNA recognition motif
ProfileScan	IPR000504	44	120	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GGGTCCTTTCCATTCCTATT
Primer_r	: CTCCCTACCGCTCTTCCATA
PCR product length	: 131 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1782 bp
Genome contig ID	gi89161213f_73126642
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTGAATGATCTTTTAAATAAAAGAAAACCTTACGT
Flanking genome sequence (122718 - 122767)	----+--------+--------+--------+--------+----* AATATTTAATGCTTGCCTTTATTTTTGAGTTCTTTTTAGCTGCTCATGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	73226642	73249358	6	99.2	Perfect prediction
ContigView(URL based/DAS)	7	r	27462523	27465001	1	98.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0038

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information