HUGE |
Gene/Protein Characteristic Table for KIAA0046 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00383 |
---|---|
Accession No. : | D28475 |
Description : | Chloride channel protein 6. |
HUGO Gene Name : | chloride channel 6 (CLCN6) |
Clone Name : | ha00519s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0046 |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha00519, former representative clones for KIAA0046 with ha00519s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5567 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2905 bp Genome contig ID gi89161185f_11688855 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TAACCCTAACATGTGAGAATAAAATGTCTTCTGTCFlanking genome sequence
(136919 - 136968) ----+----*----+----*----+----*----+----*----+----*
TCCTCTGTCTCCTTTAGCCTTTTGTCTCCATGCTGCTTTCTTTCTTTCTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 11788855 11825772 23 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 872 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 1 |
: Stanford G3 | |
: CCAGATAAGCCCAAAGAC | |
: GTGATGGGGCTGCTAATG | |
: 124 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |