HUGE

Gene/Protein Characteristic Table for KIAA0047

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04560
Accession No. :	D38554
Description :	chromatin modifying protein 1A isoform 1.
HUGO Gene Name :	chromatin modifying protein 1A (CHMP1A)
Clone Name :	ha01551 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2284 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1476 bp

Genome contig ID gi51511732r_88138347
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGAATGCTGTTGTAAATAAACAAATGGATCCCTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTTTCTCAAGCTTTGCTTTGGAGCCTTGGGTGAGCCCCTGGATGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 88238347 88251562 7 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 268 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW66715	5.3e-100	99.6	procollagen (ty...	Homo sapiens
AAC50775	3e-99	98.9	PRSM1.	Homo sapiens
NP_001076783	6.2e-87	98.8	chromatin modif...	Homo sapiens
EAW66716	4.7e-40	99.2	procollagen (ty...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR006025 151 160 PS00142 Peptidase M

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR006025	151	160	PS00142	Peptidase M

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTCCCCGACCACACCCCAATG
Primer_r	: TCTCTCAGCCTCCCAGCAAGT
PCR product length	: 178 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1476 bp
Genome contig ID	gi51511732r_88138347
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGAATGCTGTTGTAAATAAACAAATGGATCCCTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTTCTCAAGCTTTGCTTTGGAGCCTTGGGTGAGCCCCTGGATGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	88238347	88251562	7	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0047

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information