HUGE

Gene/Protein Characteristic Table for KIAA0051

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01050
Accession No. :	D29640
Description :	Ras GTPase-activating-like protein IQGAP1.
HUGO Gene Name :	IQ motif containing GTPase activating protein 1 (IQGAP1)
Clone Name :	ha00940 [Vector Info]
Flexi ORF Clone :	pF1KA0051
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6379 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1281 bp

Genome contig ID gi51511731f_88632454
PolyA signal sequence
(GATAAA,-20)
+----*----+----*----+----*----+----
AAGCTTTTGTTCTTGGATAAAAAGTCATACACTTT
Flanking genome sequence
(213173 - 213222)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAACTTTTTCCAGGAAAATATATTGAAATCATGCTGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 88732454 88845625 38 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1678 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_523157	99.9	IQ motif contai...	Pan troglodytes
P46940	100.0	Ras GTPase-acti...	Homo sapiens
AAI39732	99.9	IQ motif contai...	Homo sapiens
XP_536199	97.0	similar to Ras ...	Canis lupus fam...
XP_001498595	95.8	similar to Ras ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000593 1477 1677 PD008735 RasGAP protein

HMMPfam IPR001715 66 181 PF00307 Calponin-like actin-binding

IPR001202 702 731 PF00397 WW/Rsp5/WWP

IPR000048 767 787 PF00612 IQ calmodulin-binding region

IPR000048 797 817 PF00612 IQ calmodulin-binding region

IPR000048 827 847 PF00612 IQ calmodulin-binding region

IPR000048 857 877 PF00612 IQ calmodulin-binding region

IPR001936 1046 1258 PF00616 Ras GTPase-activating protein

IPR000593 1472 1604 PF03836 RasGAP protein

HMMSmart IPR001715 67 176 SM00033 Calponin-like actin-binding

IPR001202 701 733 SM00456 WW/Rsp5/WWP

IPR000048 765 787 SM00015 IQ calmodulin-binding region

IPR000048 795 817 SM00015 IQ calmodulin-binding region

IPR000048 825 847 SM00015 IQ calmodulin-binding region

IPR000048 855 877 SM00015 IQ calmodulin-binding region

IPR001936 1013 1366 SM00323 Ras GTPase-activating protein

ProfileScan IPR001715 65 180 PS50021 Calponin-like actin-binding

IPR001202 700 733 PS50020 WW/Rsp5/WWP

IPR000048 766 795 PS50096 IQ calmodulin-binding region

IPR000048 796 825 PS50096 IQ calmodulin-binding region

IPR000048 826 855 PS50096 IQ calmodulin-binding region

IPR000048 856 885 PS50096 IQ calmodulin-binding region

IPR001936 1025 1258 PS50018 Ras GTPase-activating protein

ScanRegExp IPR001202 706 731 PS01159 WW/Rsp5/WWP

IPR001936 1210 1224 PS00509 Ras GTPase-activating protein

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000593	1477	1677	PD008735	RasGAP protein
HMMPfam	IPR001715	66	181	PF00307	Calponin-like actin-binding
IPR001202	702	731	PF00397	WW/Rsp5/WWP
IPR000048	767	787	PF00612	IQ calmodulin-binding region
IPR000048	797	817	PF00612	IQ calmodulin-binding region
IPR000048	827	847	PF00612	IQ calmodulin-binding region
IPR000048	857	877	PF00612	IQ calmodulin-binding region
IPR001936	1046	1258	PF00616	Ras GTPase-activating protein
IPR000593	1472	1604	PF03836	RasGAP protein
HMMSmart	IPR001715	67	176	SM00033	Calponin-like actin-binding
IPR001202	701	733	SM00456	WW/Rsp5/WWP
IPR000048	765	787	SM00015	IQ calmodulin-binding region
IPR000048	795	817	SM00015	IQ calmodulin-binding region
IPR000048	825	847	SM00015	IQ calmodulin-binding region
IPR000048	855	877	SM00015	IQ calmodulin-binding region
IPR001936	1013	1366	SM00323	Ras GTPase-activating protein
ProfileScan	IPR001715	65	180	PS50021	Calponin-like actin-binding
IPR001202	700	733	PS50020	WW/Rsp5/WWP
IPR000048	766	795	PS50096	IQ calmodulin-binding region
IPR000048	796	825	PS50096	IQ calmodulin-binding region
IPR000048	826	855	PS50096	IQ calmodulin-binding region
IPR000048	856	885	PS50096	IQ calmodulin-binding region
IPR001936	1025	1258	PS50018	Ras GTPase-activating protein
ScanRegExp	IPR001202	706	731	PS01159	WW/Rsp5/WWP
IPR001936	1210	1224	PS00509	Ras GTPase-activating protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GCTACAGTATGAAGGAGTTGC
Primer_r	: TGTGGCATCGGGAGTGTATCA
PCR product length	: 237 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1281 bp
Genome contig ID	gi51511731f_88632454
PolyA signal sequence (GATAAA,-20)	+--------+--------+----*----+---- AAGCTTTTGTTCTTGGATAAAAAGTCATACACTTT
Flanking genome sequence (213173 - 213222)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACTTTTTCCAGGAAAATATATTGAAATCATGCTGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	88732454	88845625	38	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0051

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information