HUGE

Gene/Protein Characteristic Table for KIAA0056

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06111
Accession No. :	D29954
Description :	Condensin-II complex subunit D3.
HUGO Gene Name :	non-SMC condensin II complex, subunit D3 (NCAPD3)
Clone Name :	ha01062 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5023 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 498 bp

Genome contig ID gi51511727r_133427551
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GCTTTCTTAAAGTAATAAAGGTTTAGCATAAATAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCTTCCAGTAGTCAATAGGATTTTTCTGTTTTTAGAACAGAGCTCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 133527551 133599058 35 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1507 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_546388	82.3	similar to Holo...	Canis lupus fam...
AAI01929	74.8	Non-SMC condens...	Rattus norvegicus
Q6ZQK0	73.4	Condensin-2 com...	Mus musculus
NP_835214	73.3	non-SMC condens...	Mus musculus
EDL25317	73.4	RIKEN cDNA B130...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63880	0.00015	22.8	KIAA0159

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 546 581 PF02985 HEAT

IPR000357 982 1018 PF02985 HEAT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	546	581	PF02985	HEAT
IPR000357	982	1018	PF02985	HEAT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TCTCTGCATTCGCTACACCAT
Primer_r	: GAGTGCTGACAAATCGGAAGA
PCR product length	: 173 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	498 bp
Genome contig ID	gi51511727r_133427551
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GCTTTCTTAAAGTAATAAAGGTTTAGCATAAATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCTTCCAGTAGTCAATAGGATTTTTCTGTTTTTAGAACAGAGCTCTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	133527551	133599058	35	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0056

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information