HUGE |
Gene/Protein Characteristic Table for KIAA0056 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06111 |
---|---|
Accession No. : | D29954 |
Description : | Condensin-II complex subunit D3. |
HUGO Gene Name : | non-SMC condensin II complex, subunit D3 (NCAPD3) |
Clone Name : | ha01062 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5023 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 498 bp Genome contig ID gi51511727r_133427551 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
GCTTTCTTAAAGTAATAAAGGTTTAGCATAAATACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCCTTCCAGTAGTCAATAGGATTTTTCTGTTTTTAGAACAGAGCTCTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 133527551 133599058 35 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1507 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 11 |
: Stanford G3 | |
: TCTCTGCATTCGCTACACCAT | |
: GAGTGCTGACAAATCGGAAGA | |
: 173 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |