HUGE |
Gene/Protein Characteristic Table for KIAA0060 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00008 |
---|---|
Accession No. : | D31766 |
Description : | Glucosamine-6-phosphate isomerase. |
HUGO Gene Name : | glucosamine-6-phosphate deaminase 1 (GNPDA1) |
Clone Name : | ha01541 [Vector Info] |
Flexi ORF Clone : | pF1KA0060
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2613 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1342 bp Genome contig ID gi51511721r_141260427 PolyA signal sequence
(ATTAAA,-18) +----*----+----*----+----*----+----
ACAATGTGATATTTTCTATTAAATCCAGTATTTTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CAAATAACATGTCATTTGTGGATTTGAGCCCCCAATTTTAGAAGACTCTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 141360427 141372722 8 98.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 317 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 5 |
: Genebridge 4 | |
: TCCTTACACGCACTGATTTTC | |
: CTGTGAAAGTGGAAGAAGGAA | |
: 228 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |