HUGE

Gene/Protein Characteristic Table for KIAA0061

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06434
Accession No. :	D31765
Description :	Ribonucleases P/MRP protein subunit POP1.
HUGO Gene Name :
Clone Name :	ha01242 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4276 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1562 bp

Genome contig ID gi51511724f_99109820
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GCATCTGTAAACAGAATAAATGAAAATGTCACCTG
Flanking genome sequence
(131420 - 131469)
----+----*----+----*----+----*----+----*----+----*
ATGTTCAGTTGTGAATATTTATATTTATTGGACCATTCCTTATTTGTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 99209820 99241238 13 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 903 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q99575	100.0	Ribonucleases P...	Homo sapiens
AAH11529	99.8	Processing of p...	Homo sapiens
XP_001149384	99.1	processing of p...	Pan troglodytes
XP_001915387	83.9	similar to Ribo...	Equus caballus
XP_878948	80.5	similar to Ribo...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009723 1 137 PF06978 Ribonuclease P/MRP

IPR012590 496 587 PF08170 POPLD

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009723	1	137	PF06978	Ribonuclease P/MRP
IPR012590	496	587	PF08170	POPLD

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CTTTCCCTGTCCTTGCTGTAA
Primer_r	: GTCTTCTCTTGTCTTCTGCTA
PCR product length	: 235 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1562 bp
Genome contig ID	gi51511724f_99109820
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCATCTGTAAACAGAATAAATGAAAATGTCACCTG
Flanking genome sequence (131420 - 131469)	----+--------+--------+--------+--------+----* ATGTTCAGTTGTGAATATTTATATTTATTGGACCATTCCTTATTTGTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	99209820	99241238	13	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0061

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information