HUGE

Gene/Protein Characteristic Table for KIAA0063

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00390
Accession No. :	D31884
Description :	Josephin-1.
HUGO Gene Name :	Josephin domain containing 1 (JOSD1)
Clone Name :	ha01234 [Vector Info]
Flexi ORF Clone :	pF1KSDA0063
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3168 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2280 bp

Genome contig ID gi89161203r_37311573
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TTTTGTTTAACCAAATATTAAAAATGGAAAACTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATATGTCTCCTTGTCTGCCTGAATTCTATAATTGTGTAAAGAAAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 37411573 37426217 4 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 211 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15040	7.5e-91	100.0	Josephin-1; Jos...	Homo sapiens
Q5BJY4	1.9e-88	97.0	Josephin-1; Jos...	Rattus norvegicus
XP_538372	1.9e-88	97.5	similar to Jose...	Canis lupus fam...
Q9DBJ6	2.2e-88	97.0	Josephin-1; Jos...	Mus musculus
XP_001501689	5.9e-88	97.0	similar to Jose...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006155 34 208 PF02099 Machado-Joseph disease protein MJD

ProfileScan IPR006155 32 211 PS50957 Machado-Joseph disease protein MJD

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006155	34	208	PF02099	Machado-Joseph disease protein MJD
ProfileScan	IPR006155	32	211	PS50957	Machado-Joseph disease protein MJD

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CTATGAGGACTTGACACAGGT
Primer_r	: CTTTATGCTCTGGGTCCTTCA
PCR product length	: 163 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2280 bp
Genome contig ID	gi89161203r_37311573
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTTTGTTTAACCAAATATTAAAAATGGAAAACTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATATGTCTCCTTGTCTGCCTGAATTCTATAATTGTGTAAAGAAAAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	37411573	37426217	4	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0063

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information