HUGE |
Gene/Protein Characteristic Table for KIAA0064 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00391 |
---|---|
Accession No. : | D31764 |
Description : | Sorting nexin-17. |
HUGO Gene Name : | sorting nexin 17 (SNX17) |
Clone Name : | ha01355 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0064
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2043 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 408 bp Genome contig ID gi89161199f_27346893 PolyA signal sequence
(ATTAAA,-25) +----*----+----*----+----*----+----
GTTCCCCATCATTAAACTCAGCCTGACTGCTGCCTFlanking genome sequence
(106607 - 106656) ----+----*----+----*----+----*----+----*----+----*
ACCTCTGGTTCCCTCTCACTGCCCCTGCTTCCCCCATCACAGCATGGACT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 27446893 27453498 15 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 495 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 2 |
: Stanford G3 | |
: TGCTTGGATGTCTGCCCTCTA | |
: CAAGGAAAGGTAGGATACGAG | |
: 152 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |