HUGE

Gene/Protein Characteristic Table for KIAA0067

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00393
Accession No. :	D31891
Description :	Histone-lysine N-methyltransferase SETDB1.
HUGO Gene Name :	SET domain, bifurcated 1 (SETDB1)
Clone Name :	ha01038 [Vector Info]
Flexi ORF Clone :	pF1KSDA0067
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4333 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 371 bp

Genome contig ID gi89161185f_149065543
PolyA signal sequence
(GATAAA,-9)
+----*----+----*----+----*----+----
ATTTCTTGAAAGTCTTTTAACAATATGATAAAACT
Flanking genome sequence
(138294 - 138343)
----+----*----+----*----+----*----+----*----+----*
AAGATTGTGGTTTTGTTTCTCTCTCTCAGCCCGATACTCCCAATTCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 149165543 149203835 22 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1300 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15047	100.0	Histone-lysine ...	Homo sapiens
XP_524864	99.5	SET domain, bif...	Pan troglodytes
EAW53505	99.8	SET domain, bif...	Homo sapiens
EAW53506	99.9	SET domain, bif...	Homo sapiens
AAH28671	99.8	SET domain, bif...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001739 603 677 PF01429 Methyl-CpG binding

IPR007728 690 804 PF05033 Pre-SET zinc-binding region

IPR001214 806 1282 PF00856 SET

HMMSmart IPR002999 265 327 SM00333 Tudor

IPR002999 355 410 SM00333 Tudor

IPR001739 606 681 SM00391 Methyl-CpG binding

IPR003606 688 795 SM00468 Pre-SET zinc-binding sub-group

IPR001214 812 1281 SM00317 SET

ProfileScan IPR001739 603 674 PS50982 Methyl-CpG binding

IPR007728 736 809 PS50867 Pre-SET zinc-binding region

IPR001214 811 1279 PS50280 SET

IPR003616 1284 1300 PS50868 Post-SET zinc-binding region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001739	603	677	PF01429	Methyl-CpG binding
IPR007728	690	804	PF05033	Pre-SET zinc-binding region
IPR001214	806	1282	PF00856	SET
HMMSmart	IPR002999	265	327	SM00333	Tudor
IPR002999	355	410	SM00333	Tudor
IPR001739	606	681	SM00391	Methyl-CpG binding
IPR003606	688	795	SM00468	Pre-SET zinc-binding sub-group
IPR001214	812	1281	SM00317	SET
ProfileScan	IPR001739	603	674	PS50982	Methyl-CpG binding
IPR007728	736	809	PS50867	Pre-SET zinc-binding region
IPR001214	811	1279	PS50280	SET
IPR003616	1284	1300	PS50868	Post-SET zinc-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACCCCTGAGTTGTGAGTCTGG
Primer_r	: ATCCAAACCAATGCACCCAGG
PCR product length	: 109 (1.4K) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	371 bp
Genome contig ID	gi89161185f_149065543
PolyA signal sequence (GATAAA,-9)	+--------+--------+----*----+---- ATTTCTTGAAAGTCTTTTAACAATATGATAAAACT
Flanking genome sequence (138294 - 138343)	----+--------+--------+--------+--------+----* AAGATTGTGGTTTTGTTTCTCTCTCTCAGCCCGATACTCCCAATTCTGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	149165543	149203835	22	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0067

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information