HUGE |
Gene/Protein Characteristic Table for KIAA0069 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00394 |
---|---|
Accession No. : | D31885 |
Description : | ARL-6-interacting protein 1. |
HUGO Gene Name : | ADP-ribosylation factor-like 6 interacting protein 1 (ARL6IP1) |
Clone Name : | ha01508 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0069 |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2272 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1591 bp Genome contig ID gi51511732r_18610517 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
GGAAAAAATAAAAAAAGCTGGAATCTTCATGTCTCFlanking genome sequence
(99967 - 99918) ----+----*----+----*----+----*----+----*----+----*
ACTTTCTTTATAACTTAGCCAATATAATATTTATGATTGGATTTATGAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 18710484 18720358 6 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 226 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 16 |
: Stanford G3 | |
: GCAGACTTGAGGTGATGATAG | |
: CAATGGGCACCACTGTTCACA | |
: 181 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |