HUGE

Gene/Protein Characteristic Table for KIAA0070

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00395
Accession No. :	D31890
Description :	Lysyl-tRNA synthetase.
HUGO Gene Name :
Clone Name :	ha01530 [Vector Info]
Flexi ORF Clone :	pF1KSDA0070
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1970 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 162 bp

Genome contig ID gi51511732r_74119132
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
AGACAAGGAATTAAAAATTTCTTTTTAATCCTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCAAATAAGCCATTTGTCTCTTCTCTTTACTTTTAGAATATCAACTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 74219132 74239052 14 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 601 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511115	99.7	lysyl-tRNA synt...	Pan troglodytes
BAG09591	100.0	lysyl-tRNA synt...	synthetic construct
Q15046	99.8	Lysyl-tRNA synt...	Homo sapiens
XP_001104312	96.8	lysyl-tRNA synt...	Macaca mulatta
EAW95621	96.5	lysyl-tRNA synt...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002313 263 273 PR00982 Lysyl-tRNA synthetase

IPR002313 279 295 PR00982 Lysyl-tRNA synthetase

IPR002313 308 321 PR00982 Lysyl-tRNA synthetase

IPR002313 326 343 PR00982 Lysyl-tRNA synthetase

IPR002313 462 478 PR00982 Lysyl-tRNA synthetase

HMMPfam IPR004365 130 210 PF01336 Nucleic acid binding

IPR004364 226 579 PF00152 Aminoacyl-tRNA synthetase

HMMTigr IPR002313 76 581 TIGR00499 Lysyl-tRNA synthetase

ProfileScan IPR006195 248 579 PS50862 Aminoacyl-tRNA synthetase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002313	263	273	PR00982	Lysyl-tRNA synthetase
IPR002313	279	295	PR00982	Lysyl-tRNA synthetase
IPR002313	308	321	PR00982	Lysyl-tRNA synthetase
IPR002313	326	343	PR00982	Lysyl-tRNA synthetase
IPR002313	462	478	PR00982	Lysyl-tRNA synthetase
HMMPfam	IPR004365	130	210	PF01336	Nucleic acid binding
IPR004364	226	579	PF00152	Aminoacyl-tRNA synthetase
HMMTigr	IPR002313	76	581	TIGR00499	Lysyl-tRNA synthetase
ProfileScan	IPR006195	248	579	PS50862	Aminoacyl-tRNA synthetase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTAAATGGCACCGCTCTAAAG
Primer_r	: TCAGTGGTTGCTACATTCTCC
PCR product length	: 340 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	162 bp
Genome contig ID	gi51511732r_74119132
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- AGACAAGGAATTAAAAATTTCTTTTTAATCCTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCAAATAAGCCATTTGTCTCTTCTCTTTACTTTTAGAATATCAACTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	74219132	74239052	14	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0070

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information