HUGE

Gene/Protein Characteristic Table for KIAA0075

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04850
Accession No. :	D38550
Description :	Transcription factor E2F3.
HUGO Gene Name :
Clone Name :	ha01209 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3805 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3280 bp

Genome contig ID gi89161210f_20494899
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATGGTAAAGGATCAATAAAATGATTTTTTTTAAG
Flanking genome sequence
(107023 - 107072)
----+----*----+----*----+----*----+----*----+----*
AGTTCAGGCTTGTGGATGGGTTTTCTTTAATATTATCTTGTGCTCCTCTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 20594899 20601920 3 99.1 Terminal No-hit

Features of the protein sequence	Description

Length: 174 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW55422	1.4e-68	100.0	E2F transcripti...	Homo sapiens
AAI14555	1.5e-68	100.0	E2F3 protein [H...	Homo sapiens
CAH18140	2.1e-68	100.0	hypothetical pr...	Homo sapiens
EAW55421	2.1e-68	100.0	E2F transcripti...	Homo sapiens
O00716	2.8e-68	100.0	Transcription f...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TTATGACTGCGTGAGCCTTAG
Primer_r	: AGAGCCACAACAAAGAACAGA
PCR product length	: 271 bp
PCR conditions	: 95 °C15 sec62 °C120 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3280 bp
Genome contig ID	gi89161210f_20494899
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATGGTAAAGGATCAATAAAATGATTTTTTTTAAG
Flanking genome sequence (107023 - 107072)	----+--------+--------+--------+--------+----* AGTTCAGGCTTGTGGATGGGTTTTCTTTAATATTATCTTGTGCTCCTCTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	20594899	20601920	3	99.1	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0075

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information