HUGE

Gene/Protein Characteristic Table for KIAA0078

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01957
Accession No. :	D38551
Description :	Double-strand-break repair protein rad21 homolog.
HUGO Gene Name :	RAD21 homolog (S. pombe) (RAD21)
Clone Name :	ha01237 [Vector Info]
Flexi ORF Clone :	pF1KA0078
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3647 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1567 bp

Genome contig ID gi51511724r_117827355
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ATAACTTTTCTAATAAAAGTTGTGTTATAAGCTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTTTTGAGTATTCATTATTCAGTTGGTGGTGGTCCCCAAGGGAAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 117927355 117956182 14 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 635 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O60216	3.2e-208	100.0	Double-strand-b...	Homo sapiens
XP_001094435	3.6e-208	99.8	RAD21 homolog i...	Macaca mulatta
CAA66940	1e-207	99.8	HR21spA [Homo s...	Homo sapiens
XP_539142	2.3e-206	98.7	similar to Doub...	Canis lupus fam...
XP_001496357	2.9e-206	98.7	similar to Doub...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006910 5 115 PF04825 Rad21/Rec8 like protein

IPR006909 578 632 PF04824 Rad21/Rec8 like protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006910	5	115	PF04825	Rad21/Rec8 like protein
IPR006909	578	632	PF04824	Rad21/Rec8 like protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GGACACAGAACCCTTTGAGAA
Primer_r	: TGAGTCCTTGGGGTGCTGTTT
PCR product length	: 171 bp
PCR conditions	: 95 °C15 sec64 °C120 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1567 bp
Genome contig ID	gi51511724r_117827355
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATAACTTTTCTAATAAAAGTTGTGTTATAAGCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTTTTGAGTATTCATTATTCAGTTGGTGGTGGTCCCCAAGGGAAAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	117927355	117956182	14	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0078

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information