HUGE

Gene/Protein Characteristic Table for KIAA0082

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00010
Accession No. :	D43949
Description :
HUGO Gene Name :
Clone Name :	ha02350 [Vector Info]
Flexi ORF Clone :	pF1KA0082
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha01325, former representative clones for KIAA0082 with ha02350. (2003/2/07)

Features of the cloned DNA sequence	Description

Length: 4018 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1367 bp

Genome contig ID gi89161210f_37408995
PolyA signal sequence
(ATTAAA,-27)
+----*----+----*----+----*----+----
CTTGGATCATTAAAGATAAACATATTTTTAATGCC
Flanking genome sequence
(148273 - 148322)
----+----*----+----*----+----*----+----*----+----*
TGTGTGGCTCTGTGTTGGGGCTGCTGCTGTTTGTCCTCAGTGCTTTGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 37508995 37557266 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 882 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001117026	99.9	similar to CG63...	Macaca mulatta
BAF85253	99.9	unnamed protein...	Homo sapiens
AAI33560	95.2	FTSJD2 protein ...	Bos taurus
XP_001117035	95.0	similar to CG63...	Macaca mulatta
Q9DBC3	90.3	FtsJ methyltran...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000467 134 178 PF01585 D111/G-patch

IPR002877 299 498 PF01728 Ribosomal RNA methyltransferase RrmJ/FtsJ

IPR001202 801 831 PF00397 WW/Rsp5/WWP

HMMSmart IPR000467 132 178 SM00443 D111/G-patch

IPR001202 800 833 SM00456 WW/Rsp5/WWP

ProfileScan IPR000467 134 180 PS50174 D111/G-patch

ScanRegExp IPR001202 805 831 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000467	134	178	PF01585	D111/G-patch
IPR002877	299	498	PF01728	Ribosomal RNA methyltransferase RrmJ/FtsJ
IPR001202	801	831	PF00397	WW/Rsp5/WWP
HMMSmart	IPR000467	132	178	SM00443	D111/G-patch
IPR001202	800	833	SM00456	WW/Rsp5/WWP
ProfileScan	IPR000467	134	180	PS50174	D111/G-patch
ScanRegExp	IPR001202	805	831	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TGTGGGCTCTGCTGTTCTCTC
Primer_r	: TGAGTGGGGGAAGGAGACAAG
PCR product length	: 247 bp
PCR conditions	: 95 °C15 sec66 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1367 bp
Genome contig ID	gi89161210f_37408995
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- CTTGGATCATTAAAGATAAACATATTTTTAATGCC
Flanking genome sequence (148273 - 148322)	----+--------+--------+--------+--------+----* TGTGTGGCTCTGTGTTGGGGCTGCTGCTGTTTGTCCTCAGTGCTTTGTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	37508995	37557266	24	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0082

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information