HUGE |
Gene/Protein Characteristic Table for KIAA0084 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00401 |
---|---|
Accession No. : | D42043 |
Description : | Raftlin. |
HUGO Gene Name : | raftlin, lipid raft linker 1 (RFTN1) |
Clone Name : | ha02022 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0084
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2918 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 971 bp Genome contig ID gi89161205r_16232368 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TTTAGTTACTTACGGCAATAAATCATCTATGAGTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTGCACCGTGAGGATTGAGTGTTTATCGTGTCACTAGGAACAGTCCTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 16332368 16530154 10 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 648 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 3 |
: Genebridge 4 | |
: CCCATGTATGCTGTGTTTATC | |
: TAAACAAGAGAAGAGACAGGC | |
: 135 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |