HUGE

Gene/Protein Characteristic Table for KIAA0089

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00011
Accession No. :	D42047
Description :	Glycerol-3-phosphate dehydrogenase 1-like protein.
HUGO Gene Name :	glycerol-3-phosphate dehydrogenase 1-like (GPD1L)
Clone Name :	ha03662 [Vector Info]
Flexi ORF Clone :	pF1KA0089
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4043 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2806 bp

Genome contig ID gi89161205f_32023027
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TGATTTAATAAACATTTAACCCCCTAAACTTGGGG
Flanking genome sequence
(162184 - 162233)
----+----*----+----*----+----*----+----*----+----*
CACCGTGGATCCTGTTTTTCTTTTTATCAGCTTAGGTAATCATTTTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 32123027 32185209 8 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 411 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001096149	3.3e-143	94.3	similar to glyc...	Macaca mulatta
Q8N335	2.2e-140	100.0	Glycerol-3-phos...	Homo sapiens
Q5R5V3	1.8e-139	99.4	Glycerol-3-phos...	Pongo abelii
2PLA	2e-139	100.0	Crystal structu...	Homo sapiens
AAI49967	7e-137	97.4	GPD1L protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR006109 263 408 PD001278 NAD-dependent glycerol-3-phosphate dehydrogenase

FPrintScan IPR006168 70 87 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 132 159 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 208 228 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 248 272 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 273 297 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006168 316 333 PR00077 NAD-dependent glycerol-3-phosphate dehydrogenase

HMMPfam IPR011128 66 237 PF01210 NAD-dependent glycerol-3-phosphate dehydrogenase

IPR006109 254 404 PF07479 NAD-dependent glycerol-3-phosphate dehydrogenase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR006109	263	408	PD001278	NAD-dependent glycerol-3-phosphate dehydrogenase
FPrintScan	IPR006168	70	87	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	132	159	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	208	228	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	248	272	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	273	297	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006168	316	333	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
HMMPfam	IPR011128	66	237	PF01210	NAD-dependent glycerol-3-phosphate dehydrogenase
IPR006109	254	404	PF07479	NAD-dependent glycerol-3-phosphate dehydrogenase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ACTGAAGAGATTTTGGTGAGG
Primer_r	: TCAGAACCAACAATGCCACAG
PCR product length	: 146 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2806 bp
Genome contig ID	gi89161205f_32023027
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TGATTTAATAAACATTTAACCCCCTAAACTTGGGG
Flanking genome sequence (162184 - 162233)	----+--------+--------+--------+--------+----* CACCGTGGATCCTGTTTTTCTTTTTATCAGCTTAGGTAATCATTTTATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	32123027	32185209	8	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0089

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information