HUGE |
Gene/Protein Characteristic Table for KIAA0090 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00012 |
---|---|
Accession No. : | D42044 |
Description : | |
HUGO Gene Name : | |
Clone Name : | eh00576 [Vector Info] |
Flexi ORF Clone : | pF1KA0090
![]() |
Source : | |
Note : | We replaced ha03523, former representative clones for KIAA0090 with eh00576. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5411 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2435 bp Genome contig ID gi89161185r_19316071 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GACCAGCCTGGGCAACATAGCAAGACTCTATCTACFlanking genome sequence
(99884 - 99835) ----+----*----+----*----+----*----+----*----+----*
AAAAAATAAAAAAAAATTAGCCGGGCCTGGTGGCATGTGCCTGTGGTCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 19415955 19450587 23 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 991 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: |
: | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |