HUGE

Gene/Protein Characteristic Table for KIAA0092

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00013
Accession No. :	D42054
Description :	Centrosomal protein of 57 kDa.
HUGO Gene Name :	centrosomal protein 57kDa (CEP57)
Clone Name :	ha01343 [Vector Info]
Flexi ORF Clone :	pF1KA0092
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2913 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1435 bp

Genome contig ID gi51511727f_95063458
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
AATTTCAGGTCATTAAATTGTATAACCATCATTTG
Flanking genome sequence
(142047 - 142096)
----+----*----+----*----+----*----+----*----+----*
AATTGTAGTGGCTCTGAGTCCTAATTAGGAGAATGGTGATTGAATGATGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 95163458 95205503 10 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 475 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11132	2.1e-142	100.0	centrosomal pro...	synthetic construct
EAW66968	1.9e-141	99.6	centrosomal pro...	Homo sapiens
XP_001093445	2.9e-135	96.6	similar to tran...	Macaca mulatta
XP_855815	7.2e-129	90.1	similar to tran...	Canis lupus fam...
EDL24981	5.6e-124	87.6	centrosomal pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010597 32 475 PF06657 Protein of unknown function DUF1167

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010597	32	475	PF06657	Protein of unknown function DUF1167

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TACATAGAAAGAGAGCCCAAG
Primer_r	: CAAACAAGGAGATAACAGGAG
PCR product length	: 293 bp
PCR conditions	: 95 °C15 sec60 °C60 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1435 bp
Genome contig ID	gi51511727f_95063458
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- AATTTCAGGTCATTAAATTGTATAACCATCATTTG
Flanking genome sequence (142047 - 142096)	----+--------+--------+--------+--------+----* AATTGTAGTGGCTCTGAGTCCTAATTAGGAGAATGGTGATTGAATGATGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	95163458	95205503	10	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0092

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information