HUGE |
Gene/Protein Characteristic Table for KIAA0100 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00016 |
---|---|
Accession No. : | D43947 |
Description : | |
HUGO Gene Name : | |
Clone Name : | ef04121 [Vector Info] |
Flexi ORF Clone : | pF1KA0100 |
Source : | |
Note : | We replaced ha00902, former representative clones for KIAA0100 with ef04121. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7393 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 610 bp Genome contig ID gi51511734r_23865616 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GCAAAATGATTTAAAGAGAAAAAAAAAGATATTTTFlanking genome sequence
(99983 - 99934) ----+----*----+----*----+----*----+----*----+----*
AAATTTGATGCTCATTTTTGTGTGTGTGTGTTGAGTGCATGCATTCAATC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 23965599 23996276 39 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2235 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 17 |
: Stanford G3 | |
: GAACAACCTCCTCCCCAATGC | |
: CATCATCTTCCACACTTCGGC | |
: 153 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |