HUGE |
Gene/Protein Characteristic Table for KIAA0102 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00409 |
---|---|
Accession No. : | D14658 |
Description : | Signal peptidase complex subunit 2. |
HUGO Gene Name : | signal peptidase complex subunit 2 homolog (S. cerevisiae) (SPCS2) |
Clone Name : | ha00791 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0102
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1370 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 691 bp Genome contig ID gi51511727f_74237981 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
CTAAAATTTTTTTCAATAAAAGGAAGGAAGATGTGFlanking genome sequence
(128448 - 128497) ----+----*----+----*----+----*----+----*----+----*
AAAAAAATGGAGTCATAGTTTTGATGGAGAGAACAGAGAAACAAGTGTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 74337981 74366427 5 100.0 Perfect prediction ContigView(URL based/DAS) 1 r 28294148 28295518 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 225 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 11 |
: Genebridge 4 | |
: AGTGGGAGAACAAAGCAGCAG | |
: TTTTTATCTCCCCCACCCCCC | |
: 223 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |