HUGE

Gene/Protein Characteristic Table for KIAA0105

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07372
Accession No. :	D14661
Description :	Wilms' tumor 1-associating protein.
HUGO Gene Name :	Wilms tumor 1 associated protein (WTAP)
Clone Name :	ha00682 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1622 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1042 bp

Genome contig ID gi89161210f_159968610
PolyA signal sequence
(ATTAAA,-14)
+----*----+----*----+----*----+----
GTATTGCACTCTTGATATTAAATTAAATGTGCCTT
Flanking genome sequence
(121829 - 121878)
----+----*----+----*----+----*----+----*----+----*
GAAATAGTTGGTTTTTTTTTTTTTTTAAGTTCAAAGAATATTATGATGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 160068610 160090437 6 100.0 Perfect prediction

ContigView(URL based/DAS) 6 r 51381790 51383302 1 96.0 Terminal No-hit

Features of the protein sequence	Description

Length: 192 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL02022	2.7e-50	86.1	mCG16685, isofo...	Mus musculus
XP_001509735	5.4e-50	100.0	similar to Wilm...	Ornithorhynchus...
XP_001150391	9.1e-50	97.5	similar to puta...	Pan troglodytes
EDL02020	1.1e-49	86.0	mCG16685, isofo...	Mus musculus
EAW47628	2.7e-49	100.0	Wilms tumor 1 a...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ACCTCAAGCAAGTCCAGCAGC
Primer_r	: AAGCAAGGGGAAGGGGAAAAG
PCR product length	: 353 bp
PCR conditions	: 95 °C15 sec68 °C120 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1042 bp
Genome contig ID	gi89161210f_159968610
PolyA signal sequence (ATTAAA,-14)	+--------+--------+----*----+---- GTATTGCACTCTTGATATTAAATTAAATGTGCCTT
Flanking genome sequence (121829 - 121878)	----+--------+--------+--------+--------+----* GAAATAGTTGGTTTTTTTTTTTTTTTAAGTTCAAAGAATATTATGATGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	160068610	160090437	6	100.0	Perfect prediction
ContigView(URL based/DAS)	6	r	51381790	51383302	1	96.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0105

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information